annasnyder1234 annasnyder1234

03-08-2018
History

contestada

a way of drawing a flat map that helps to reduce distortion

a way of drawing a flat map that helps to reduce distortion class=

Respuesta :

03-08-2018

a way of drawing a flat map with reduced distortion is MAP PROJECTION.

Answer Link

Otras preguntas

Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

In the united states during world war ii, the property of japanese americans was confiscated, and they were forcibly placed in ______.

How did censorship and propaganda help fortify post ww1 dictatorships?

Read the following excerpt from Sandra Cisneros’s story "Mericans." “Por favor,” says the lady. “¿Un foto?” pointing to her camera. “Si.” She’s so busy taking

NEED HELP WORTH 50 POINTS !! Holly has a rectangular garden that measures 12 m wide by 14 m long. She wants to increase the area to 255 m2 by increasing the wi

I’m confused !!! Help

who invented the glass harmonica

Self-efficacy is ________.our level of confidence in our own abilitiesthe belief that we have power over our livesa state of being in which our thoughts about o

The sterile material that is placed directly on a wound is termed the: