jalish1leyCut
jalish1leyCut jalish1leyCut
  • 04-04-2016
  • History
contestada

The _____ era was an artistic movement in the late 1800s that encouraged imagination and individualism.

Respuesta :

HistoryGuy HistoryGuy
  • 05-04-2016
The "romantic" era was an artistic movement in the late 1800s that encouraged imagination and individualism--which impacted several different mediums from visual art to music. 
Answer Link

Otras preguntas

how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
Suppose 5\8 of the area of a garden is flowers. Zinnias cover 3\4 of the flower area. What fraction of the garden is zinnias?
the perimeter of a square 116ft ?
Angela has 24 golf balls and 18 golf clubs. She wants to sell packages of balls and paddles bundled together. What is the greatest number of packages she can se
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Please help me with this two step math problem! THANK YOU !!!!!!!!
find the prime factorization 504
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
what rule does static electricity follow