marcuspalustre1405 marcuspalustre1405
  • 01-06-2021
  • Biology
contestada

Using complete sentences:

Describe the difference(s) between local and global winds.

Respuesta :

avuhlolz
avuhlolz avuhlolz
  • 01-06-2021

Explanation:

The term global winds refers to the six major wind belts that encircle the globe.

Local winds, however, are the winds, or breezes, that are stirred up by the temperatures and topographical features of a small region or area. This is especially true of coastal areas.

Answer Link

Otras preguntas

compare and contrast the reading and travelling​
Solve the following expression when f = 2 & s = 8 s ÷ (2f)
Write the converse of the statement If two angles are supplementary and congruent, then they are right angles.
HELPPPPPPPPPP PLEASE
Identify the product of genetic engineering. A. inserting a spider’s silk gene in a goat’s DNA to weave silk threads B. choosing livestock for mating to pass
why is it easier to swim in sea than in a pond or river?​
3x + 2y = 1 5x – 2y = 39
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
How was the organization of the government under the United States Constitution different from the system under the Articles of Confederation?
Which polynomial equation is a valid identity?