nboucher28 nboucher28
  • 04-03-2022
  • Mathematics
contestada

what is 37 1/4 x 24 help me

Respuesta :

TissuePaper TissuePaper
  • 04-03-2022

37 and 1 / 4 = 37 * 6 = 74 * 3 = 222

Answer Link

Otras preguntas

what is 3/5 of 21? plz answer the question
For some time, the English had little interest in colonizing for what two reasons?
Multivitamin/mineral supplements should never be given to toddlers. a. True b. False
30.0 ml of an hf solution were titrated with 22.15 ml of a 0.122 m koh solution to reach the equivalence point. what is the molarity of the hf solution?
Secured it means a lender gives you money in exchange for what?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
How did censorship and propaganda help fortify post ww1 dictatorships?
Solve the equation. Identify any extraneous solutions. x=sqrt2x+24 6 and 4 are both extraneous solutions. 4 is a solution to the original equation. The value –6
In the adult, the internal reproductive organs and the urinary bladder are "housed" in which body cavity?
a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?