Morahtashant Morahtashant
  • 03-03-2017
  • Mathematics
contestada

What is the slope m and y-intercept point of the line y = 2x 1?

Respuesta :

RedNutella
RedNutella RedNutella
  • 03-03-2017
The slope is 2 and the y-intercept is 1.
Answer Link

Otras preguntas

How do you write fifty-seven thousand,eighteen. In standard form
A generator stores electric current. Explain why you agree or disagree with this statement
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
Help PleaSE:) ->Grammar Which sentence has a pronoun with an unclear, missing, or confusing antecedent? A. The lifeguards sat in tall chairs; they could
what are 2 points on the graph for 6x-5y=25
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
why did Mr Collins come to the Bennet family looking for a wife?
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage