Seudónimo Seudónimo
  • 01-08-2015
  • History
contestada

What word should you avoid when correcting a child?

Respuesta :

HistoryGuy HistoryGuy
  • 02-08-2015
In general you should avoid overtly negative words when correcting a child, such as "stupid". These words can hurt the child's self-esteem and make it harder for them to learn in the future. 
Answer Link

Otras preguntas

a antonym for biosphere
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
why did russia have revolution in 1917?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
why is the square root of a perfect square always rational
what is the percent change from 70 to 56?
how many 1 1/2 centimeter cubes can fit into a rectangular prism that has a length of 12 centimeters , a width of 6 centimeters and a height of 9 centimeters
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
2ln(5x)=8 solve for x