begum01aytekin begum01aytekin

02-01-2016
World Languages

contestada

Hz.Mohammed ,what year were you born ?

Respuesta :

bookishfairy73 bookishfairy73

02-01-2016

Mohammed the prophet was born in 570 A.D

Answer Link

Otras preguntas

How did world war i and the treaty of versailles contribute to the rise of fascism in the 1920s and 30s?

A guitarist uses ________ to recall how to play the notes of a specific song. episodic memory procedural memory semantic memory a flashbulb memory

31. The skin, lungs, and digestive system __________. A. transport broken-down chemicals out of the body B. are not affected by drugs C. always speed up when dr

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Why was gerald ford called the "unelected president"?

PLEASE HELP ASAP find the quotient of -12x^3 + 21x^2 - 6x/ -3x.-4x^2 - 7x + 184x^2 + 7x + 18-12x^3 + 21x^2 + 24x^2 - 7x + 2

which function has the solution set shown in the graph?

Self-efficacy is ________.our level of confidence in our own abilitiesthe belief that we have power over our livesa state of being in which our thoughts about o

The hydrosphere includes _____ 2.20 unit assessment: fundamentals of ecology, part 1

Tell what whole number you can substitute for x in the following list so the numbers are ordered from least to greatest. 2/x ,x/6, 70%